Review



resource source identifier antibodies gfp proteintech  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Proteintech resource source identifier antibodies gfp proteintech
    Resource Source Identifier Antibodies Gfp Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 285 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/ATG7+Antibody/pm41932333-276-2-7
    Average 96 stars, based on 285 article reviews
    resource source identifier antibodies gfp proteintech - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Bacteria:

    Article Title: Glutamylation of an HIV-1 protein inhibits the immune response by hijacking STING.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat # 50430-2-AP; RRID:AB_11042881 GST Cwbio Cat # CW0085M His Cwbio Cat # CW0083M HA Sigma Aldrich Cat #H6908; RRID:AB_260070 Flag Sigma Aldrich Cat #F7425; RRID:AB_439687 LMNB1 BOSTER Cat # BA1228 K27-polyubiquitin Abclonal Cat # A18202; RRID:AB_2861979 TRIM32 Absin Cat # abs137045 AMFR Cell Signaling Technology Cat # 9590; RRID:AB_10860080 GT335 Adipogen Cat # AG-20B-0020-C100 Phospho-TBK1 Cell Signaling Technology Cat # 5483; RRID:AB_10693472 Phospho-NF-kB p65 (Ser536) Cell Signaling Technology Cat # 3033; RRID:AB_331284 Phospho-IRF-3 (Ser396) Cell Signaling Technology Cat # 29047; RRID:AB_2773013 Phospho-STING (Ser365) Cell Signaling Technology Cat # 72971; RRID:AB_2799831 Phospho-p44/42 MAPK (Erk1/2) Cell Signaling Technology Cat # 9101; RRID:AB_331646 Phospho-p38 MAPK Cell Signaling Technology Cat # 9215; RRID:AB_331762 IRF-3 Cell Signaling Technology Cat # 4302; RRID:AB_1904036 cGAS Cell Signaling Technology Cat # 15102; RRID:AB_2732795 STING Proteintech Cat # 66680-1-Ig; RRID:AB_2882034 STING Cell Signaling Technology Cat # 13647; RRID:AB_2732796 K63-polyubiquitin Cell Signaling Technology Cat # 5621S; RRID:AB_10827985 Anti-rabbit-HRP Cell Signaling Technology Cat # 7074; RRID:AB_2099233 Anti-mouse-HRP Servicebio Cat # GB23301; RRID:AB_2904020 GAPDH Sigma Aldrich Cat #G9545; RRID:AB_796208 p24 antibody (P5F1) Liu et al.55 N/A Bacteria and virus strains E. coli BL21(DE3) Tiangen Biotech Cat # CB105 HSV-1 Wang et al.56 N/A SeV Zhang et al.32 N/A Chemicals, peptides, and recombinant proteins Anti-Flag M2 Affinity Gel Sigma Aldrich Cat # A2220 Anti-GFP Affinity Beads Smart-Lifesciences Cat # SA070001 PEG8000 VETEC Cat #V900156 Type IV Collagenase Gibco Cat # 17104019 hGM-CSF Peprotech Cat # 300-03 RNAiso Plus Takara Cat # 9109 Isopropropyl b-D-1-thiogalactopyranoside Sigma Aldrich Cat #I6758 Ni-NTA resins Smart-Lifesciences Cat # SA005010 Glutathione resins Smart-Lifesciences Cat # SA010010 lipofectamineTM 2000 ThermoFisher Scientific Cat # 11668019 2‘3’-cGAMP invivogene Cat # tlrl-nacga23-02 HT-DNA Sigma Aldrich Cat #D1626 Poly (I:C) invivogene Cat # tlrl-pic CoCl2 Sigma Aldrich Cat # 7647-79-9 (Continued on next page) 16 Cell Reports 42, 112442, May 30, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Luciferase Assay System Promega Cat #E1501 Fast Mutagensis System kit TRANSGEN Cat # FM1-11-01 Duolink in situ Red Sigma Aldrich Cat # DUO92101 Capsid Protein p24 ELISA Kit SinoBiological Cat # KIT11695 CD4+ T cell Isolation Kit, Human Miltenyi Biotec Cat # 130-096-533 PrimeScript TM RT reagent kit Takara Cat # RR037 Universal SYBR qPCR Master Mix Vazyme Cat #Q711-02 Deposited data RNA sequence data This paper GSE189384 Experimental models: Cell lines HEK293T National Collection of Authenticated Cell Cultures Cat # SCSP-502 Mouse embryonic fibroblast This paper N/A Primary CD4+ T cell This paper N/A TZM-bl Liu et al.57 N/A Vero National Collection of Authenticated Cell Cultures Cat # GNO10 THP-1 National Collection of Authenticated Cell Cultures Cat # TCHu57 Tmem173 / THP-1 Ning et al.58 N/A MT-4 cells Liu et al.57 N/A Monocyte-derived macrophages This paper N/A Experimental models: Organisms/strains Mouse: C57/BL6 Shanghai Jiesijie laboratory animal N/A Oligonucleotides A list of primers used in this experiment is listed in Table S1 This paper N/A A list of siRNA used in this experiment is listed in Table S2 This paper N/A Software and algorithms Data analysis GraphPad Prism version 6 https://www.graphpad.com Image analysis ImageJ https://imagej.nih.gov/ij

    Virus:

    Article Title: Glutamylation of an HIV-1 protein inhibits the immune response by hijacking STING.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat # 50430-2-AP; RRID:AB_11042881 GST Cwbio Cat # CW0085M His Cwbio Cat # CW0083M HA Sigma Aldrich Cat #H6908; RRID:AB_260070 Flag Sigma Aldrich Cat #F7425; RRID:AB_439687 LMNB1 BOSTER Cat # BA1228 K27-polyubiquitin Abclonal Cat # A18202; RRID:AB_2861979 TRIM32 Absin Cat # abs137045 AMFR Cell Signaling Technology Cat # 9590; RRID:AB_10860080 GT335 Adipogen Cat # AG-20B-0020-C100 Phospho-TBK1 Cell Signaling Technology Cat # 5483; RRID:AB_10693472 Phospho-NF-kB p65 (Ser536) Cell Signaling Technology Cat # 3033; RRID:AB_331284 Phospho-IRF-3 (Ser396) Cell Signaling Technology Cat # 29047; RRID:AB_2773013 Phospho-STING (Ser365) Cell Signaling Technology Cat # 72971; RRID:AB_2799831 Phospho-p44/42 MAPK (Erk1/2) Cell Signaling Technology Cat # 9101; RRID:AB_331646 Phospho-p38 MAPK Cell Signaling Technology Cat # 9215; RRID:AB_331762 IRF-3 Cell Signaling Technology Cat # 4302; RRID:AB_1904036 cGAS Cell Signaling Technology Cat # 15102; RRID:AB_2732795 STING Proteintech Cat # 66680-1-Ig; RRID:AB_2882034 STING Cell Signaling Technology Cat # 13647; RRID:AB_2732796 K63-polyubiquitin Cell Signaling Technology Cat # 5621S; RRID:AB_10827985 Anti-rabbit-HRP Cell Signaling Technology Cat # 7074; RRID:AB_2099233 Anti-mouse-HRP Servicebio Cat # GB23301; RRID:AB_2904020 GAPDH Sigma Aldrich Cat #G9545; RRID:AB_796208 p24 antibody (P5F1) Liu et al.55 N/A Bacteria and virus strains E. coli BL21(DE3) Tiangen Biotech Cat # CB105 HSV-1 Wang et al.56 N/A SeV Zhang et al.32 N/A Chemicals, peptides, and recombinant proteins Anti-Flag M2 Affinity Gel Sigma Aldrich Cat # A2220 Anti-GFP Affinity Beads Smart-Lifesciences Cat # SA070001 PEG8000 VETEC Cat #V900156 Type IV Collagenase Gibco Cat # 17104019 hGM-CSF Peprotech Cat # 300-03 RNAiso Plus Takara Cat # 9109 Isopropropyl b-D-1-thiogalactopyranoside Sigma Aldrich Cat #I6758 Ni-NTA resins Smart-Lifesciences Cat # SA005010 Glutathione resins Smart-Lifesciences Cat # SA010010 lipofectamineTM 2000 ThermoFisher Scientific Cat # 11668019 2‘3’-cGAMP invivogene Cat # tlrl-nacga23-02 HT-DNA Sigma Aldrich Cat #D1626 Poly (I:C) invivogene Cat # tlrl-pic CoCl2 Sigma Aldrich Cat # 7647-79-9 (Continued on next page) 16 Cell Reports 42, 112442, May 30, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Luciferase Assay System Promega Cat #E1501 Fast Mutagensis System kit TRANSGEN Cat # FM1-11-01 Duolink in situ Red Sigma Aldrich Cat # DUO92101 Capsid Protein p24 ELISA Kit SinoBiological Cat # KIT11695 CD4+ T cell Isolation Kit, Human Miltenyi Biotec Cat # 130-096-533 PrimeScript TM RT reagent kit Takara Cat # RR037 Universal SYBR qPCR Master Mix Vazyme Cat #Q711-02 Deposited data RNA sequence data This paper GSE189384 Experimental models: Cell lines HEK293T National Collection of Authenticated Cell Cultures Cat # SCSP-502 Mouse embryonic fibroblast This paper N/A Primary CD4+ T cell This paper N/A TZM-bl Liu et al.57 N/A Vero National Collection of Authenticated Cell Cultures Cat # GNO10 THP-1 National Collection of Authenticated Cell Cultures Cat # TCHu57 Tmem173 / THP-1 Ning et al.58 N/A MT-4 cells Liu et al.57 N/A Monocyte-derived macrophages This paper N/A Experimental models: Organisms/strains Mouse: C57/BL6 Shanghai Jiesijie laboratory animal N/A Oligonucleotides A list of primers used in this experiment is listed in Table S1 This paper N/A A list of siRNA used in this experiment is listed in Table S2 This paper N/A Software and algorithms Data analysis GraphPad Prism version 6 https://www.graphpad.com Image analysis ImageJ https://imagej.nih.gov/ij

    Article Title: Upregulation of neuronal ER-phagy improves organismal fitness and alleviates APP toxicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# 50430-2-AP; RRID: AB_11042881 a-Tubulin Sigma Cat# T5168; RRID: AB_477579 Calnexin Developmental Studies Hybridoma Bank Cat# Cnx99A 6-2-1 Actin Proteintech Cat# 60008-1-1g; RRID: AB_2289225 b-Amyloid (1–42) Cell Signaling Technology Cat# 14974; RRID: AB_2798671 Anti-mouse APP Proteintech Cat# 60342-1-Ig; RRID: AB_2881451 HA Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Ubiquitin HUABIO Cat# ET1609-21; RRID: AB_3069833 Gabarap Abcam Cat# AB109364; RRID: AB_10861928 Pdi This study N/A Anti-goat APP Sigma Cat# AB1593 Ref2P Abcam Cat# 178440; RRID: AB_2938801 ATF4 Proteintech Cat# 60035-1-Ig; RRID: AB_2058598 Crc Dr. Zengyi Huang N/A Anti-rabbit Alexa Fluor 647 ABclonal Cat# A5060; RRID: AB_2766001 Anti-mouse Alexa Fluor cy3 Proteintech Cat# SA00009-1; RRID: AB_2814746 Anti-mouse Alexa Fluor 488 ABclonal Cat# AS076; RRID: AB_2768316 Anti-rabbit Alexa Fluor 488 Abcam Cat# AB150077; RRID: AB_2630356 Anti-Goat Alexa Fluor 647 Thermo Fisher Cat# A56570; RRID: AB_2930909 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H + L) Jackson Cat# 115-035-003; RRID: AB_10015289 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H + L) Jackson Cat# 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a chemically competent cells Thermo Fisher Cat# EC0112 BL21 E.coli strain ZOMANBIO Cat# ZK201 pAcmCherry-KDEL-C1 Dr. Gia Voeltz N/A Chemicals, peptides, and recombinant proteins DAPI Solarbio Cat# D8200-10mg LysoTracker red DND-99 Yeason Cat# 40739ES50 Rapamycin Selleck Cat# AY-22989 Protease inhibitor cocktail Roche Cat# 4693132001 PMSF Sangon Biotech Cat# A100754-0005 Chloroquine diphosphate Sigma Cat# C668 Hematoxylin stain solution Beyotime Cat# C0107 Eosin dye Beyotime Cat# C0109 TRIzol reagent Invitrogen Cat# 15596026 Misfedone Thermo Fisher Cat# T3166 Schneider’s Drosophila medium Gibco Cat# R690074 Vectashield Mounting Medium Vector Lab Cat# H-1000-10 Ni NTA Beads 6FF Smart–lifesciences Cat# SA005010 Critical commercial assays HiScript III RT SuperMix Vazyme Cat# R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 (Continued on next page) Cell Reports 43, 114255, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid extraction kit TIANGEN Cat# DP103-02 ECL chemiluminescent substrate reagent kit Yeason Cat# 36224FS10 Blood/tissue DNA extraction kit HANLINBO Cat# DP-304-02 Experimental models: Organisms/strains Pdi-GFP/TM3, Sb, Ser Bloomington Drosophila Stock Center BDSC: 6839 Attp2 Tsinghua Fly Center N/A Atg1 RNAi Tsinghua Fly Center N/A Uvrag RNAi Tsinghua Fly Center N/A Atl RNAi Tsinghua Fly Center N/A Vps13 RNAi Tsinghua Fly Center N/A Rtnl1 mutant Bloomington Drosophila Stock Center BDSC: 43386 W1118 Bloomington Drosophila Stock Center BDSC: 3605 Atl OE This study N/A Rtnl OE This study N/A QUAS-APP This study N/A mCherry-KDEL This study N/A Atg1 OE Bloomington Drosophila Stock Center BDSC: 60733 Lamp1-GFP; TM3, ser/TM6B Dr. Wei Song N/A If/CyO; TM3, ser/TM6B Dr. Wei Song N/A dp62-HA Dr. Chao Tong N/A APP-YFP Bloomington Drosophila Stock Center BDSC: 32039 APP695 Bloomington Drosophila Stock Center BDSC: 6700 sqh-EYFP-KDEL Bloomington Drosophila Stock Center BDSC: 7195 mCherry-Atg8a Bloomington Drosophila Stock Center BDSC: 37750 Da-gal4 Bloomington Drosophila Stock Center BDSC: 37291 Elav-gal4 Bloomington Drosophila Stock Center BDSC: 458 Elav-GeneSwitch Bloomington Drosophila Stock Center BDSC: 43642 nSyb-QF2w Bloomington Drosophila Stock Center BDSC: 51960 Atl-GIM mutant OE This study N/A Rtnl-LIR mutant OE This study N/A Elav; Ab42/CyO Dr. Bing Zhou N/A Oligonucleotides Atl-F (EcoRI) CCGGAATTCACCATAATGGGCGGATCGGCAG This study Atl-R (KpnI) CGGGGTACCTCATGACCGCTTCACCTTGCCATTG This study Rtnl1-F (EcoRI) GGAATTCTAGAATATGGATCGGAACTTCGACG This study Rtnl1-R (KpnI) CGGGGTACCTTACTTGTCCTTCTCAGACTCGG This study mCherry-KDEL-F (EcoRI) CCGGAATTCATGAAGCTCTCCCTGGTGG This study mCherry-KDEL-R (KpnI) CGGGGTACCTCATAGCTCGTCTTTCTTGTACAG This study APP-F (NotI) GTCGCGATGCTGCCCGGTT This study APP-R (XbaI) CTAGTTCTGCATCTGCTCAAAGAAC This study Pdi-pET28a construct -F TCGCGGATCCGAATTCCCCGCAATGAAATTCCTG This study Pdi-pET28a construct -R GAGTGCGGCCGCTTACAACTCGTCCTTCTTGG This study Recombinant DNA Atl-pUAST This study N/A Rtnl1-pUAST This study N/A mCherry-KDEL-pUAST This study N/A APP-pQUAST This study N/A Pdi-pET28a This study N/A (Continued on next page) 18 Cell Reports 43, 114255, May 28, 2024

    Recombinant:

    Article Title: Glutamylation of an HIV-1 protein inhibits the immune response by hijacking STING.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat # 50430-2-AP; RRID:AB_11042881 GST Cwbio Cat # CW0085M His Cwbio Cat # CW0083M HA Sigma Aldrich Cat #H6908; RRID:AB_260070 Flag Sigma Aldrich Cat #F7425; RRID:AB_439687 LMNB1 BOSTER Cat # BA1228 K27-polyubiquitin Abclonal Cat # A18202; RRID:AB_2861979 TRIM32 Absin Cat # abs137045 AMFR Cell Signaling Technology Cat # 9590; RRID:AB_10860080 GT335 Adipogen Cat # AG-20B-0020-C100 Phospho-TBK1 Cell Signaling Technology Cat # 5483; RRID:AB_10693472 Phospho-NF-kB p65 (Ser536) Cell Signaling Technology Cat # 3033; RRID:AB_331284 Phospho-IRF-3 (Ser396) Cell Signaling Technology Cat # 29047; RRID:AB_2773013 Phospho-STING (Ser365) Cell Signaling Technology Cat # 72971; RRID:AB_2799831 Phospho-p44/42 MAPK (Erk1/2) Cell Signaling Technology Cat # 9101; RRID:AB_331646 Phospho-p38 MAPK Cell Signaling Technology Cat # 9215; RRID:AB_331762 IRF-3 Cell Signaling Technology Cat # 4302; RRID:AB_1904036 cGAS Cell Signaling Technology Cat # 15102; RRID:AB_2732795 STING Proteintech Cat # 66680-1-Ig; RRID:AB_2882034 STING Cell Signaling Technology Cat # 13647; RRID:AB_2732796 K63-polyubiquitin Cell Signaling Technology Cat # 5621S; RRID:AB_10827985 Anti-rabbit-HRP Cell Signaling Technology Cat # 7074; RRID:AB_2099233 Anti-mouse-HRP Servicebio Cat # GB23301; RRID:AB_2904020 GAPDH Sigma Aldrich Cat #G9545; RRID:AB_796208 p24 antibody (P5F1) Liu et al.55 N/A Bacteria and virus strains E. coli BL21(DE3) Tiangen Biotech Cat # CB105 HSV-1 Wang et al.56 N/A SeV Zhang et al.32 N/A Chemicals, peptides, and recombinant proteins Anti-Flag M2 Affinity Gel Sigma Aldrich Cat # A2220 Anti-GFP Affinity Beads Smart-Lifesciences Cat # SA070001 PEG8000 VETEC Cat #V900156 Type IV Collagenase Gibco Cat # 17104019 hGM-CSF Peprotech Cat # 300-03 RNAiso Plus Takara Cat # 9109 Isopropropyl b-D-1-thiogalactopyranoside Sigma Aldrich Cat #I6758 Ni-NTA resins Smart-Lifesciences Cat # SA005010 Glutathione resins Smart-Lifesciences Cat # SA010010 lipofectamineTM 2000 ThermoFisher Scientific Cat # 11668019 2‘3’-cGAMP invivogene Cat # tlrl-nacga23-02 HT-DNA Sigma Aldrich Cat #D1626 Poly (I:C) invivogene Cat # tlrl-pic CoCl2 Sigma Aldrich Cat # 7647-79-9 (Continued on next page) 16 Cell Reports 42, 112442, May 30, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Luciferase Assay System Promega Cat #E1501 Fast Mutagensis System kit TRANSGEN Cat # FM1-11-01 Duolink in situ Red Sigma Aldrich Cat # DUO92101 Capsid Protein p24 ELISA Kit SinoBiological Cat # KIT11695 CD4+ T cell Isolation Kit, Human Miltenyi Biotec Cat # 130-096-533 PrimeScript TM RT reagent kit Takara Cat # RR037 Universal SYBR qPCR Master Mix Vazyme Cat #Q711-02 Deposited data RNA sequence data This paper GSE189384 Experimental models: Cell lines HEK293T National Collection of Authenticated Cell Cultures Cat # SCSP-502 Mouse embryonic fibroblast This paper N/A Primary CD4+ T cell This paper N/A TZM-bl Liu et al.57 N/A Vero National Collection of Authenticated Cell Cultures Cat # GNO10 THP-1 National Collection of Authenticated Cell Cultures Cat # TCHu57 Tmem173 / THP-1 Ning et al.58 N/A MT-4 cells Liu et al.57 N/A Monocyte-derived macrophages This paper N/A Experimental models: Organisms/strains Mouse: C57/BL6 Shanghai Jiesijie laboratory animal N/A Oligonucleotides A list of primers used in this experiment is listed in Table S1 This paper N/A A list of siRNA used in this experiment is listed in Table S2 This paper N/A Software and algorithms Data analysis GraphPad Prism version 6 https://www.graphpad.com Image analysis ImageJ https://imagej.nih.gov/ij

    Article Title: Upregulation of neuronal ER-phagy improves organismal fitness and alleviates APP toxicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# 50430-2-AP; RRID: AB_11042881 a-Tubulin Sigma Cat# T5168; RRID: AB_477579 Calnexin Developmental Studies Hybridoma Bank Cat# Cnx99A 6-2-1 Actin Proteintech Cat# 60008-1-1g; RRID: AB_2289225 b-Amyloid (1–42) Cell Signaling Technology Cat# 14974; RRID: AB_2798671 Anti-mouse APP Proteintech Cat# 60342-1-Ig; RRID: AB_2881451 HA Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Ubiquitin HUABIO Cat# ET1609-21; RRID: AB_3069833 Gabarap Abcam Cat# AB109364; RRID: AB_10861928 Pdi This study N/A Anti-goat APP Sigma Cat# AB1593 Ref2P Abcam Cat# 178440; RRID: AB_2938801 ATF4 Proteintech Cat# 60035-1-Ig; RRID: AB_2058598 Crc Dr. Zengyi Huang N/A Anti-rabbit Alexa Fluor 647 ABclonal Cat# A5060; RRID: AB_2766001 Anti-mouse Alexa Fluor cy3 Proteintech Cat# SA00009-1; RRID: AB_2814746 Anti-mouse Alexa Fluor 488 ABclonal Cat# AS076; RRID: AB_2768316 Anti-rabbit Alexa Fluor 488 Abcam Cat# AB150077; RRID: AB_2630356 Anti-Goat Alexa Fluor 647 Thermo Fisher Cat# A56570; RRID: AB_2930909 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H + L) Jackson Cat# 115-035-003; RRID: AB_10015289 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H + L) Jackson Cat# 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a chemically competent cells Thermo Fisher Cat# EC0112 BL21 E.coli strain ZOMANBIO Cat# ZK201 pAcmCherry-KDEL-C1 Dr. Gia Voeltz N/A Chemicals, peptides, and recombinant proteins DAPI Solarbio Cat# D8200-10mg LysoTracker red DND-99 Yeason Cat# 40739ES50 Rapamycin Selleck Cat# AY-22989 Protease inhibitor cocktail Roche Cat# 4693132001 PMSF Sangon Biotech Cat# A100754-0005 Chloroquine diphosphate Sigma Cat# C668 Hematoxylin stain solution Beyotime Cat# C0107 Eosin dye Beyotime Cat# C0109 TRIzol reagent Invitrogen Cat# 15596026 Misfedone Thermo Fisher Cat# T3166 Schneider’s Drosophila medium Gibco Cat# R690074 Vectashield Mounting Medium Vector Lab Cat# H-1000-10 Ni NTA Beads 6FF Smart–lifesciences Cat# SA005010 Critical commercial assays HiScript III RT SuperMix Vazyme Cat# R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 (Continued on next page) Cell Reports 43, 114255, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid extraction kit TIANGEN Cat# DP103-02 ECL chemiluminescent substrate reagent kit Yeason Cat# 36224FS10 Blood/tissue DNA extraction kit HANLINBO Cat# DP-304-02 Experimental models: Organisms/strains Pdi-GFP/TM3, Sb, Ser Bloomington Drosophila Stock Center BDSC: 6839 Attp2 Tsinghua Fly Center N/A Atg1 RNAi Tsinghua Fly Center N/A Uvrag RNAi Tsinghua Fly Center N/A Atl RNAi Tsinghua Fly Center N/A Vps13 RNAi Tsinghua Fly Center N/A Rtnl1 mutant Bloomington Drosophila Stock Center BDSC: 43386 W1118 Bloomington Drosophila Stock Center BDSC: 3605 Atl OE This study N/A Rtnl OE This study N/A QUAS-APP This study N/A mCherry-KDEL This study N/A Atg1 OE Bloomington Drosophila Stock Center BDSC: 60733 Lamp1-GFP; TM3, ser/TM6B Dr. Wei Song N/A If/CyO; TM3, ser/TM6B Dr. Wei Song N/A dp62-HA Dr. Chao Tong N/A APP-YFP Bloomington Drosophila Stock Center BDSC: 32039 APP695 Bloomington Drosophila Stock Center BDSC: 6700 sqh-EYFP-KDEL Bloomington Drosophila Stock Center BDSC: 7195 mCherry-Atg8a Bloomington Drosophila Stock Center BDSC: 37750 Da-gal4 Bloomington Drosophila Stock Center BDSC: 37291 Elav-gal4 Bloomington Drosophila Stock Center BDSC: 458 Elav-GeneSwitch Bloomington Drosophila Stock Center BDSC: 43642 nSyb-QF2w Bloomington Drosophila Stock Center BDSC: 51960 Atl-GIM mutant OE This study N/A Rtnl-LIR mutant OE This study N/A Elav; Ab42/CyO Dr. Bing Zhou N/A Oligonucleotides Atl-F (EcoRI) CCGGAATTCACCATAATGGGCGGATCGGCAG This study Atl-R (KpnI) CGGGGTACCTCATGACCGCTTCACCTTGCCATTG This study Rtnl1-F (EcoRI) GGAATTCTAGAATATGGATCGGAACTTCGACG This study Rtnl1-R (KpnI) CGGGGTACCTTACTTGTCCTTCTCAGACTCGG This study mCherry-KDEL-F (EcoRI) CCGGAATTCATGAAGCTCTCCCTGGTGG This study mCherry-KDEL-R (KpnI) CGGGGTACCTCATAGCTCGTCTTTCTTGTACAG This study APP-F (NotI) GTCGCGATGCTGCCCGGTT This study APP-R (XbaI) CTAGTTCTGCATCTGCTCAAAGAAC This study Pdi-pET28a construct -F TCGCGGATCCGAATTCCCCGCAATGAAATTCCTG This study Pdi-pET28a construct -R GAGTGCGGCCGCTTACAACTCGTCCTTCTTGG This study Recombinant DNA Atl-pUAST This study N/A Rtnl1-pUAST This study N/A mCherry-KDEL-pUAST This study N/A APP-pQUAST This study N/A Pdi-pET28a This study N/A (Continued on next page) 18 Cell Reports 43, 114255, May 28, 2024

    Article Title: A nature-inspired nanoplatform for multi-protein targeted degradation via the autophagy-lysosome pathway.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# CL488-66002, RRID:AB_2919276 ATG7 Proteintech Cat# 10088-2-AP, RRID:AB_2062351 β-actin Proteintech Cat# 81115-1-RR, RRID:AB_2923704 LampI Abcam Cat# ab25630, RRID:AB_470708 LampII Proteintech Cat# 27823-1-AP, RRID:AB_2880983 TMEM201 Proteintech Cat# 24092-1-AP, RRID:AB_2879430 SFXN4 Affinity Cat# DF3325, RRID:AB_2835692 SEC11A Proteintech Cat# 14753-1-AP, RRID:AB_2186230 SNX18 Proteintech Cat# 21946-1-AP, RRID:AB_11182387 REEP4 Proteintech Cat# 26650-1-AP, RRID:AB_2880589 SUN2 Proteintech Cat# 27556-1-AP, RRID:AB_2880906 LC3B Proteintech Cat# CL594-18725, RRID:AB_2919848 CD63 Proteintech Cat# 25682-1-AP, RRID:AB_2783831 ALIX Proteintech Cat# 12422-1-AP, RRID:AB_2162467 CD9 Proteintech Cat# 60232-1-Ig, RRID:AB_11232215 TSG101 Proteintech Cat# 28283-1-AP, RRID:AB_2881104 HA Proteintech Cat# CL488-51064, RRID:AB_2935603 Flag Proteintech Cat# 66008-3-Ig, RRID:AB_2749837 GST Proteintech Cat# 66001-1-Ig, RRID:AB_10951482 EEA1 Proteintech Cat# 68065-1-Ig, RRID:AB_2918806 Rab7a Proteintech Cat# CL488-55469, RRID:AB_3084130 EGFR Abcam Cat# ab32198, RRID:AB_732100 PDL1 Abcam Cat# ab205921, RRID:AB_2687878 VEGF Abcam Cat# ab52917, RRID:AB_883427 Chemicals, peptides, and recombinant proteins Bafilomycin A1 MedChemExpress Cat#HY-100558 MG132 MedChemExpress Cat#HY-13259 ULK101 MedChemExpress Cat#HY-114490 Wortmannin MedChemExpress Cat#HY-10197 SAR405 MedChemExpress Cat#HY-12481 NSC185058 MedChemExpress Cat#HY-125169 NHS-biotin MedChemExpress Cat#HY-D0802 PKH26 Sigma-Aldrich Cat#MINI26 CFSE Selleck Cat#S8269 pHrodo deep red Thermofisher Cat#P35357 Critical commercial assays GST purification kit Beyotime Cat#P2262 NaveniFlex Cell Red PLA kit Naveni Cat#60025 Annexin V-FITC/PI apoptosis kit Elabscience Cat#E-CK-A211 Deposited data The mass spectrometry proteomics data This paper iProX: PXD072326 http://proteomecentral. proteomexchange.org/cgi/ GetDataset?ID=PXD072326 (Continued on next page) e1 Cell Chemical Biology 33, 1–15.e1–e7, April 16, 2026 .. HEK293T (female), HeLa (female), and A549 (male) cells were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (Gibco).

    Ubiquitin Proteomics:

    Article Title: Upregulation of neuronal ER-phagy improves organismal fitness and alleviates APP toxicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# 50430-2-AP; RRID: AB_11042881 a-Tubulin Sigma Cat# T5168; RRID: AB_477579 Calnexin Developmental Studies Hybridoma Bank Cat# Cnx99A 6-2-1 Actin Proteintech Cat# 60008-1-1g; RRID: AB_2289225 b-Amyloid (1–42) Cell Signaling Technology Cat# 14974; RRID: AB_2798671 Anti-mouse APP Proteintech Cat# 60342-1-Ig; RRID: AB_2881451 HA Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Ubiquitin HUABIO Cat# ET1609-21; RRID: AB_3069833 Gabarap Abcam Cat# AB109364; RRID: AB_10861928 Pdi This study N/A Anti-goat APP Sigma Cat# AB1593 Ref2P Abcam Cat# 178440; RRID: AB_2938801 ATF4 Proteintech Cat# 60035-1-Ig; RRID: AB_2058598 Crc Dr. Zengyi Huang N/A Anti-rabbit Alexa Fluor 647 ABclonal Cat# A5060; RRID: AB_2766001 Anti-mouse Alexa Fluor cy3 Proteintech Cat# SA00009-1; RRID: AB_2814746 Anti-mouse Alexa Fluor 488 ABclonal Cat# AS076; RRID: AB_2768316 Anti-rabbit Alexa Fluor 488 Abcam Cat# AB150077; RRID: AB_2630356 Anti-Goat Alexa Fluor 647 Thermo Fisher Cat# A56570; RRID: AB_2930909 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H + L) Jackson Cat# 115-035-003; RRID: AB_10015289 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H + L) Jackson Cat# 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a chemically competent cells Thermo Fisher Cat# EC0112 BL21 E.coli strain ZOMANBIO Cat# ZK201 pAcmCherry-KDEL-C1 Dr. Gia Voeltz N/A Chemicals, peptides, and recombinant proteins DAPI Solarbio Cat# D8200-10mg LysoTracker red DND-99 Yeason Cat# 40739ES50 Rapamycin Selleck Cat# AY-22989 Protease inhibitor cocktail Roche Cat# 4693132001 PMSF Sangon Biotech Cat# A100754-0005 Chloroquine diphosphate Sigma Cat# C668 Hematoxylin stain solution Beyotime Cat# C0107 Eosin dye Beyotime Cat# C0109 TRIzol reagent Invitrogen Cat# 15596026 Misfedone Thermo Fisher Cat# T3166 Schneider’s Drosophila medium Gibco Cat# R690074 Vectashield Mounting Medium Vector Lab Cat# H-1000-10 Ni NTA Beads 6FF Smart–lifesciences Cat# SA005010 Critical commercial assays HiScript III RT SuperMix Vazyme Cat# R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 (Continued on next page) Cell Reports 43, 114255, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid extraction kit TIANGEN Cat# DP103-02 ECL chemiluminescent substrate reagent kit Yeason Cat# 36224FS10 Blood/tissue DNA extraction kit HANLINBO Cat# DP-304-02 Experimental models: Organisms/strains Pdi-GFP/TM3, Sb, Ser Bloomington Drosophila Stock Center BDSC: 6839 Attp2 Tsinghua Fly Center N/A Atg1 RNAi Tsinghua Fly Center N/A Uvrag RNAi Tsinghua Fly Center N/A Atl RNAi Tsinghua Fly Center N/A Vps13 RNAi Tsinghua Fly Center N/A Rtnl1 mutant Bloomington Drosophila Stock Center BDSC: 43386 W1118 Bloomington Drosophila Stock Center BDSC: 3605 Atl OE This study N/A Rtnl OE This study N/A QUAS-APP This study N/A mCherry-KDEL This study N/A Atg1 OE Bloomington Drosophila Stock Center BDSC: 60733 Lamp1-GFP; TM3, ser/TM6B Dr. Wei Song N/A If/CyO; TM3, ser/TM6B Dr. Wei Song N/A dp62-HA Dr. Chao Tong N/A APP-YFP Bloomington Drosophila Stock Center BDSC: 32039 APP695 Bloomington Drosophila Stock Center BDSC: 6700 sqh-EYFP-KDEL Bloomington Drosophila Stock Center BDSC: 7195 mCherry-Atg8a Bloomington Drosophila Stock Center BDSC: 37750 Da-gal4 Bloomington Drosophila Stock Center BDSC: 37291 Elav-gal4 Bloomington Drosophila Stock Center BDSC: 458 Elav-GeneSwitch Bloomington Drosophila Stock Center BDSC: 43642 nSyb-QF2w Bloomington Drosophila Stock Center BDSC: 51960 Atl-GIM mutant OE This study N/A Rtnl-LIR mutant OE This study N/A Elav; Ab42/CyO Dr. Bing Zhou N/A Oligonucleotides Atl-F (EcoRI) CCGGAATTCACCATAATGGGCGGATCGGCAG This study Atl-R (KpnI) CGGGGTACCTCATGACCGCTTCACCTTGCCATTG This study Rtnl1-F (EcoRI) GGAATTCTAGAATATGGATCGGAACTTCGACG This study Rtnl1-R (KpnI) CGGGGTACCTTACTTGTCCTTCTCAGACTCGG This study mCherry-KDEL-F (EcoRI) CCGGAATTCATGAAGCTCTCCCTGGTGG This study mCherry-KDEL-R (KpnI) CGGGGTACCTCATAGCTCGTCTTTCTTGTACAG This study APP-F (NotI) GTCGCGATGCTGCCCGGTT This study APP-R (XbaI) CTAGTTCTGCATCTGCTCAAAGAAC This study Pdi-pET28a construct -F TCGCGGATCCGAATTCCCCGCAATGAAATTCCTG This study Pdi-pET28a construct -R GAGTGCGGCCGCTTACAACTCGTCCTTCTTGG This study Recombinant DNA Atl-pUAST This study N/A Rtnl1-pUAST This study N/A mCherry-KDEL-pUAST This study N/A APP-pQUAST This study N/A Pdi-pET28a This study N/A (Continued on next page) 18 Cell Reports 43, 114255, May 28, 2024

    Protease Inhibitor:

    Article Title: Upregulation of neuronal ER-phagy improves organismal fitness and alleviates APP toxicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# 50430-2-AP; RRID: AB_11042881 a-Tubulin Sigma Cat# T5168; RRID: AB_477579 Calnexin Developmental Studies Hybridoma Bank Cat# Cnx99A 6-2-1 Actin Proteintech Cat# 60008-1-1g; RRID: AB_2289225 b-Amyloid (1–42) Cell Signaling Technology Cat# 14974; RRID: AB_2798671 Anti-mouse APP Proteintech Cat# 60342-1-Ig; RRID: AB_2881451 HA Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Ubiquitin HUABIO Cat# ET1609-21; RRID: AB_3069833 Gabarap Abcam Cat# AB109364; RRID: AB_10861928 Pdi This study N/A Anti-goat APP Sigma Cat# AB1593 Ref2P Abcam Cat# 178440; RRID: AB_2938801 ATF4 Proteintech Cat# 60035-1-Ig; RRID: AB_2058598 Crc Dr. Zengyi Huang N/A Anti-rabbit Alexa Fluor 647 ABclonal Cat# A5060; RRID: AB_2766001 Anti-mouse Alexa Fluor cy3 Proteintech Cat# SA00009-1; RRID: AB_2814746 Anti-mouse Alexa Fluor 488 ABclonal Cat# AS076; RRID: AB_2768316 Anti-rabbit Alexa Fluor 488 Abcam Cat# AB150077; RRID: AB_2630356 Anti-Goat Alexa Fluor 647 Thermo Fisher Cat# A56570; RRID: AB_2930909 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H + L) Jackson Cat# 115-035-003; RRID: AB_10015289 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H + L) Jackson Cat# 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a chemically competent cells Thermo Fisher Cat# EC0112 BL21 E.coli strain ZOMANBIO Cat# ZK201 pAcmCherry-KDEL-C1 Dr. Gia Voeltz N/A Chemicals, peptides, and recombinant proteins DAPI Solarbio Cat# D8200-10mg LysoTracker red DND-99 Yeason Cat# 40739ES50 Rapamycin Selleck Cat# AY-22989 Protease inhibitor cocktail Roche Cat# 4693132001 PMSF Sangon Biotech Cat# A100754-0005 Chloroquine diphosphate Sigma Cat# C668 Hematoxylin stain solution Beyotime Cat# C0107 Eosin dye Beyotime Cat# C0109 TRIzol reagent Invitrogen Cat# 15596026 Misfedone Thermo Fisher Cat# T3166 Schneider’s Drosophila medium Gibco Cat# R690074 Vectashield Mounting Medium Vector Lab Cat# H-1000-10 Ni NTA Beads 6FF Smart–lifesciences Cat# SA005010 Critical commercial assays HiScript III RT SuperMix Vazyme Cat# R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 (Continued on next page) Cell Reports 43, 114255, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid extraction kit TIANGEN Cat# DP103-02 ECL chemiluminescent substrate reagent kit Yeason Cat# 36224FS10 Blood/tissue DNA extraction kit HANLINBO Cat# DP-304-02 Experimental models: Organisms/strains Pdi-GFP/TM3, Sb, Ser Bloomington Drosophila Stock Center BDSC: 6839 Attp2 Tsinghua Fly Center N/A Atg1 RNAi Tsinghua Fly Center N/A Uvrag RNAi Tsinghua Fly Center N/A Atl RNAi Tsinghua Fly Center N/A Vps13 RNAi Tsinghua Fly Center N/A Rtnl1 mutant Bloomington Drosophila Stock Center BDSC: 43386 W1118 Bloomington Drosophila Stock Center BDSC: 3605 Atl OE This study N/A Rtnl OE This study N/A QUAS-APP This study N/A mCherry-KDEL This study N/A Atg1 OE Bloomington Drosophila Stock Center BDSC: 60733 Lamp1-GFP; TM3, ser/TM6B Dr. Wei Song N/A If/CyO; TM3, ser/TM6B Dr. Wei Song N/A dp62-HA Dr. Chao Tong N/A APP-YFP Bloomington Drosophila Stock Center BDSC: 32039 APP695 Bloomington Drosophila Stock Center BDSC: 6700 sqh-EYFP-KDEL Bloomington Drosophila Stock Center BDSC: 7195 mCherry-Atg8a Bloomington Drosophila Stock Center BDSC: 37750 Da-gal4 Bloomington Drosophila Stock Center BDSC: 37291 Elav-gal4 Bloomington Drosophila Stock Center BDSC: 458 Elav-GeneSwitch Bloomington Drosophila Stock Center BDSC: 43642 nSyb-QF2w Bloomington Drosophila Stock Center BDSC: 51960 Atl-GIM mutant OE This study N/A Rtnl-LIR mutant OE This study N/A Elav; Ab42/CyO Dr. Bing Zhou N/A Oligonucleotides Atl-F (EcoRI) CCGGAATTCACCATAATGGGCGGATCGGCAG This study Atl-R (KpnI) CGGGGTACCTCATGACCGCTTCACCTTGCCATTG This study Rtnl1-F (EcoRI) GGAATTCTAGAATATGGATCGGAACTTCGACG This study Rtnl1-R (KpnI) CGGGGTACCTTACTTGTCCTTCTCAGACTCGG This study mCherry-KDEL-F (EcoRI) CCGGAATTCATGAAGCTCTCCCTGGTGG This study mCherry-KDEL-R (KpnI) CGGGGTACCTCATAGCTCGTCTTTCTTGTACAG This study APP-F (NotI) GTCGCGATGCTGCCCGGTT This study APP-R (XbaI) CTAGTTCTGCATCTGCTCAAAGAAC This study Pdi-pET28a construct -F TCGCGGATCCGAATTCCCCGCAATGAAATTCCTG This study Pdi-pET28a construct -R GAGTGCGGCCGCTTACAACTCGTCCTTCTTGG This study Recombinant DNA Atl-pUAST This study N/A Rtnl1-pUAST This study N/A mCherry-KDEL-pUAST This study N/A APP-pQUAST This study N/A Pdi-pET28a This study N/A (Continued on next page) 18 Cell Reports 43, 114255, May 28, 2024

    Staining:

    Article Title: Upregulation of neuronal ER-phagy improves organismal fitness and alleviates APP toxicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# 50430-2-AP; RRID: AB_11042881 a-Tubulin Sigma Cat# T5168; RRID: AB_477579 Calnexin Developmental Studies Hybridoma Bank Cat# Cnx99A 6-2-1 Actin Proteintech Cat# 60008-1-1g; RRID: AB_2289225 b-Amyloid (1–42) Cell Signaling Technology Cat# 14974; RRID: AB_2798671 Anti-mouse APP Proteintech Cat# 60342-1-Ig; RRID: AB_2881451 HA Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Ubiquitin HUABIO Cat# ET1609-21; RRID: AB_3069833 Gabarap Abcam Cat# AB109364; RRID: AB_10861928 Pdi This study N/A Anti-goat APP Sigma Cat# AB1593 Ref2P Abcam Cat# 178440; RRID: AB_2938801 ATF4 Proteintech Cat# 60035-1-Ig; RRID: AB_2058598 Crc Dr. Zengyi Huang N/A Anti-rabbit Alexa Fluor 647 ABclonal Cat# A5060; RRID: AB_2766001 Anti-mouse Alexa Fluor cy3 Proteintech Cat# SA00009-1; RRID: AB_2814746 Anti-mouse Alexa Fluor 488 ABclonal Cat# AS076; RRID: AB_2768316 Anti-rabbit Alexa Fluor 488 Abcam Cat# AB150077; RRID: AB_2630356 Anti-Goat Alexa Fluor 647 Thermo Fisher Cat# A56570; RRID: AB_2930909 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H + L) Jackson Cat# 115-035-003; RRID: AB_10015289 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H + L) Jackson Cat# 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a chemically competent cells Thermo Fisher Cat# EC0112 BL21 E.coli strain ZOMANBIO Cat# ZK201 pAcmCherry-KDEL-C1 Dr. Gia Voeltz N/A Chemicals, peptides, and recombinant proteins DAPI Solarbio Cat# D8200-10mg LysoTracker red DND-99 Yeason Cat# 40739ES50 Rapamycin Selleck Cat# AY-22989 Protease inhibitor cocktail Roche Cat# 4693132001 PMSF Sangon Biotech Cat# A100754-0005 Chloroquine diphosphate Sigma Cat# C668 Hematoxylin stain solution Beyotime Cat# C0107 Eosin dye Beyotime Cat# C0109 TRIzol reagent Invitrogen Cat# 15596026 Misfedone Thermo Fisher Cat# T3166 Schneider’s Drosophila medium Gibco Cat# R690074 Vectashield Mounting Medium Vector Lab Cat# H-1000-10 Ni NTA Beads 6FF Smart–lifesciences Cat# SA005010 Critical commercial assays HiScript III RT SuperMix Vazyme Cat# R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 (Continued on next page) Cell Reports 43, 114255, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid extraction kit TIANGEN Cat# DP103-02 ECL chemiluminescent substrate reagent kit Yeason Cat# 36224FS10 Blood/tissue DNA extraction kit HANLINBO Cat# DP-304-02 Experimental models: Organisms/strains Pdi-GFP/TM3, Sb, Ser Bloomington Drosophila Stock Center BDSC: 6839 Attp2 Tsinghua Fly Center N/A Atg1 RNAi Tsinghua Fly Center N/A Uvrag RNAi Tsinghua Fly Center N/A Atl RNAi Tsinghua Fly Center N/A Vps13 RNAi Tsinghua Fly Center N/A Rtnl1 mutant Bloomington Drosophila Stock Center BDSC: 43386 W1118 Bloomington Drosophila Stock Center BDSC: 3605 Atl OE This study N/A Rtnl OE This study N/A QUAS-APP This study N/A mCherry-KDEL This study N/A Atg1 OE Bloomington Drosophila Stock Center BDSC: 60733 Lamp1-GFP; TM3, ser/TM6B Dr. Wei Song N/A If/CyO; TM3, ser/TM6B Dr. Wei Song N/A dp62-HA Dr. Chao Tong N/A APP-YFP Bloomington Drosophila Stock Center BDSC: 32039 APP695 Bloomington Drosophila Stock Center BDSC: 6700 sqh-EYFP-KDEL Bloomington Drosophila Stock Center BDSC: 7195 mCherry-Atg8a Bloomington Drosophila Stock Center BDSC: 37750 Da-gal4 Bloomington Drosophila Stock Center BDSC: 37291 Elav-gal4 Bloomington Drosophila Stock Center BDSC: 458 Elav-GeneSwitch Bloomington Drosophila Stock Center BDSC: 43642 nSyb-QF2w Bloomington Drosophila Stock Center BDSC: 51960 Atl-GIM mutant OE This study N/A Rtnl-LIR mutant OE This study N/A Elav; Ab42/CyO Dr. Bing Zhou N/A Oligonucleotides Atl-F (EcoRI) CCGGAATTCACCATAATGGGCGGATCGGCAG This study Atl-R (KpnI) CGGGGTACCTCATGACCGCTTCACCTTGCCATTG This study Rtnl1-F (EcoRI) GGAATTCTAGAATATGGATCGGAACTTCGACG This study Rtnl1-R (KpnI) CGGGGTACCTTACTTGTCCTTCTCAGACTCGG This study mCherry-KDEL-F (EcoRI) CCGGAATTCATGAAGCTCTCCCTGGTGG This study mCherry-KDEL-R (KpnI) CGGGGTACCTCATAGCTCGTCTTTCTTGTACAG This study APP-F (NotI) GTCGCGATGCTGCCCGGTT This study APP-R (XbaI) CTAGTTCTGCATCTGCTCAAAGAAC This study Pdi-pET28a construct -F TCGCGGATCCGAATTCCCCGCAATGAAATTCCTG This study Pdi-pET28a construct -R GAGTGCGGCCGCTTACAACTCGTCCTTCTTGG This study Recombinant DNA Atl-pUAST This study N/A Rtnl1-pUAST This study N/A mCherry-KDEL-pUAST This study N/A APP-pQUAST This study N/A Pdi-pET28a This study N/A (Continued on next page) 18 Cell Reports 43, 114255, May 28, 2024

    Real-time Polymerase Chain Reaction:

    Article Title: Upregulation of neuronal ER-phagy improves organismal fitness and alleviates APP toxicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# 50430-2-AP; RRID: AB_11042881 a-Tubulin Sigma Cat# T5168; RRID: AB_477579 Calnexin Developmental Studies Hybridoma Bank Cat# Cnx99A 6-2-1 Actin Proteintech Cat# 60008-1-1g; RRID: AB_2289225 b-Amyloid (1–42) Cell Signaling Technology Cat# 14974; RRID: AB_2798671 Anti-mouse APP Proteintech Cat# 60342-1-Ig; RRID: AB_2881451 HA Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Ubiquitin HUABIO Cat# ET1609-21; RRID: AB_3069833 Gabarap Abcam Cat# AB109364; RRID: AB_10861928 Pdi This study N/A Anti-goat APP Sigma Cat# AB1593 Ref2P Abcam Cat# 178440; RRID: AB_2938801 ATF4 Proteintech Cat# 60035-1-Ig; RRID: AB_2058598 Crc Dr. Zengyi Huang N/A Anti-rabbit Alexa Fluor 647 ABclonal Cat# A5060; RRID: AB_2766001 Anti-mouse Alexa Fluor cy3 Proteintech Cat# SA00009-1; RRID: AB_2814746 Anti-mouse Alexa Fluor 488 ABclonal Cat# AS076; RRID: AB_2768316 Anti-rabbit Alexa Fluor 488 Abcam Cat# AB150077; RRID: AB_2630356 Anti-Goat Alexa Fluor 647 Thermo Fisher Cat# A56570; RRID: AB_2930909 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H + L) Jackson Cat# 115-035-003; RRID: AB_10015289 Horseradish Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H + L) Jackson Cat# 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a chemically competent cells Thermo Fisher Cat# EC0112 BL21 E.coli strain ZOMANBIO Cat# ZK201 pAcmCherry-KDEL-C1 Dr. Gia Voeltz N/A Chemicals, peptides, and recombinant proteins DAPI Solarbio Cat# D8200-10mg LysoTracker red DND-99 Yeason Cat# 40739ES50 Rapamycin Selleck Cat# AY-22989 Protease inhibitor cocktail Roche Cat# 4693132001 PMSF Sangon Biotech Cat# A100754-0005 Chloroquine diphosphate Sigma Cat# C668 Hematoxylin stain solution Beyotime Cat# C0107 Eosin dye Beyotime Cat# C0109 TRIzol reagent Invitrogen Cat# 15596026 Misfedone Thermo Fisher Cat# T3166 Schneider’s Drosophila medium Gibco Cat# R690074 Vectashield Mounting Medium Vector Lab Cat# H-1000-10 Ni NTA Beads 6FF Smart–lifesciences Cat# SA005010 Critical commercial assays HiScript III RT SuperMix Vazyme Cat# R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 (Continued on next page) Cell Reports 43, 114255, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid extraction kit TIANGEN Cat# DP103-02 ECL chemiluminescent substrate reagent kit Yeason Cat# 36224FS10 Blood/tissue DNA extraction kit HANLINBO Cat# DP-304-02 Experimental models: Organisms/strains Pdi-GFP/TM3, Sb, Ser Bloomington Drosophila Stock Center BDSC: 6839 Attp2 Tsinghua Fly Center N/A Atg1 RNAi Tsinghua Fly Center N/A Uvrag RNAi Tsinghua Fly Center N/A Atl RNAi Tsinghua Fly Center N/A Vps13 RNAi Tsinghua Fly Center N/A Rtnl1 mutant Bloomington Drosophila Stock Center BDSC: 43386 W1118 Bloomington Drosophila Stock Center BDSC: 3605 Atl OE This study N/A Rtnl OE This study N/A QUAS-APP This study N/A mCherry-KDEL This study N/A Atg1 OE Bloomington Drosophila Stock Center BDSC: 60733 Lamp1-GFP; TM3, ser/TM6B Dr. Wei Song N/A If/CyO; TM3, ser/TM6B Dr. Wei Song N/A dp62-HA Dr. Chao Tong N/A APP-YFP Bloomington Drosophila Stock Center BDSC: 32039 APP695 Bloomington Drosophila Stock Center BDSC: 6700 sqh-EYFP-KDEL Bloomington Drosophila Stock Center BDSC: 7195 mCherry-Atg8a Bloomington Drosophila Stock Center BDSC: 37750 Da-gal4 Bloomington Drosophila Stock Center BDSC: 37291 Elav-gal4 Bloomington Drosophila Stock Center BDSC: 458 Elav-GeneSwitch Bloomington Drosophila Stock Center BDSC: 43642 nSyb-QF2w Bloomington Drosophila Stock Center BDSC: 51960 Atl-GIM mutant OE This study N/A Rtnl-LIR mutant OE This study N/A Elav; Ab42/CyO Dr. Bing Zhou N/A Oligonucleotides Atl-F (EcoRI) CCGGAATTCACCATAATGGGCGGATCGGCAG This study Atl-R (KpnI) CGGGGTACCTCATGACCGCTTCACCTTGCCATTG This study Rtnl1-F (EcoRI) GGAATTCTAGAATATGGATCGGAACTTCGACG This study Rtnl1-R (KpnI) CGGGGTACCTTACTTGTCCTTCTCAGACTCGG This study mCherry-KDEL-F (EcoRI) CCGGAATTCATGAAGCTCTCCCTGGTGG This study mCherry-KDEL-R (KpnI) CGGGGTACCTCATAGCTCGTCTTTCTTGTACAG This study APP-F (NotI) GTCGCGATGCTGCCCGGTT This study APP-R (XbaI) CTAGTTCTGCATCTGCTCAAAGAAC This study Pdi-pET28a construct -F TCGCGGATCCGAATTCCCCGCAATGAAATTCCTG This study Pdi-pET28a construct -R GAGTGCGGCCGCTTACAACTCGTCCTTCTTGG This study Recombinant DNA Atl-pUAST This study N/A Rtnl1-pUAST This study N/A mCherry-KDEL-pUAST This study N/A APP-pQUAST This study N/A Pdi-pET28a This study N/A (Continued on next page) 18 Cell Reports 43, 114255, May 28, 2024

    Purification:

    Article Title: A nature-inspired nanoplatform for multi-protein targeted degradation via the autophagy-lysosome pathway.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# CL488-66002, RRID:AB_2919276 ATG7 Proteintech Cat# 10088-2-AP, RRID:AB_2062351 β-actin Proteintech Cat# 81115-1-RR, RRID:AB_2923704 LampI Abcam Cat# ab25630, RRID:AB_470708 LampII Proteintech Cat# 27823-1-AP, RRID:AB_2880983 TMEM201 Proteintech Cat# 24092-1-AP, RRID:AB_2879430 SFXN4 Affinity Cat# DF3325, RRID:AB_2835692 SEC11A Proteintech Cat# 14753-1-AP, RRID:AB_2186230 SNX18 Proteintech Cat# 21946-1-AP, RRID:AB_11182387 REEP4 Proteintech Cat# 26650-1-AP, RRID:AB_2880589 SUN2 Proteintech Cat# 27556-1-AP, RRID:AB_2880906 LC3B Proteintech Cat# CL594-18725, RRID:AB_2919848 CD63 Proteintech Cat# 25682-1-AP, RRID:AB_2783831 ALIX Proteintech Cat# 12422-1-AP, RRID:AB_2162467 CD9 Proteintech Cat# 60232-1-Ig, RRID:AB_11232215 TSG101 Proteintech Cat# 28283-1-AP, RRID:AB_2881104 HA Proteintech Cat# CL488-51064, RRID:AB_2935603 Flag Proteintech Cat# 66008-3-Ig, RRID:AB_2749837 GST Proteintech Cat# 66001-1-Ig, RRID:AB_10951482 EEA1 Proteintech Cat# 68065-1-Ig, RRID:AB_2918806 Rab7a Proteintech Cat# CL488-55469, RRID:AB_3084130 EGFR Abcam Cat# ab32198, RRID:AB_732100 PDL1 Abcam Cat# ab205921, RRID:AB_2687878 VEGF Abcam Cat# ab52917, RRID:AB_883427 Chemicals, peptides, and recombinant proteins Bafilomycin A1 MedChemExpress Cat#HY-100558 MG132 MedChemExpress Cat#HY-13259 ULK101 MedChemExpress Cat#HY-114490 Wortmannin MedChemExpress Cat#HY-10197 SAR405 MedChemExpress Cat#HY-12481 NSC185058 MedChemExpress Cat#HY-125169 NHS-biotin MedChemExpress Cat#HY-D0802 PKH26 Sigma-Aldrich Cat#MINI26 CFSE Selleck Cat#S8269 pHrodo deep red Thermofisher Cat#P35357 Critical commercial assays GST purification kit Beyotime Cat#P2262 NaveniFlex Cell Red PLA kit Naveni Cat#60025 Annexin V-FITC/PI apoptosis kit Elabscience Cat#E-CK-A211 Deposited data The mass spectrometry proteomics data This paper iProX: PXD072326 http://proteomecentral. proteomexchange.org/cgi/ GetDataset?ID=PXD072326 (Continued on next page) e1 Cell Chemical Biology 33, 1–15.e1–e7, April 16, 2026 .. HEK293T (female), HeLa (female), and A549 (male) cells were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (Gibco).

    Proximity Ligation Assay:

    Article Title: A nature-inspired nanoplatform for multi-protein targeted degradation via the autophagy-lysosome pathway.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# CL488-66002, RRID:AB_2919276 ATG7 Proteintech Cat# 10088-2-AP, RRID:AB_2062351 β-actin Proteintech Cat# 81115-1-RR, RRID:AB_2923704 LampI Abcam Cat# ab25630, RRID:AB_470708 LampII Proteintech Cat# 27823-1-AP, RRID:AB_2880983 TMEM201 Proteintech Cat# 24092-1-AP, RRID:AB_2879430 SFXN4 Affinity Cat# DF3325, RRID:AB_2835692 SEC11A Proteintech Cat# 14753-1-AP, RRID:AB_2186230 SNX18 Proteintech Cat# 21946-1-AP, RRID:AB_11182387 REEP4 Proteintech Cat# 26650-1-AP, RRID:AB_2880589 SUN2 Proteintech Cat# 27556-1-AP, RRID:AB_2880906 LC3B Proteintech Cat# CL594-18725, RRID:AB_2919848 CD63 Proteintech Cat# 25682-1-AP, RRID:AB_2783831 ALIX Proteintech Cat# 12422-1-AP, RRID:AB_2162467 CD9 Proteintech Cat# 60232-1-Ig, RRID:AB_11232215 TSG101 Proteintech Cat# 28283-1-AP, RRID:AB_2881104 HA Proteintech Cat# CL488-51064, RRID:AB_2935603 Flag Proteintech Cat# 66008-3-Ig, RRID:AB_2749837 GST Proteintech Cat# 66001-1-Ig, RRID:AB_10951482 EEA1 Proteintech Cat# 68065-1-Ig, RRID:AB_2918806 Rab7a Proteintech Cat# CL488-55469, RRID:AB_3084130 EGFR Abcam Cat# ab32198, RRID:AB_732100 PDL1 Abcam Cat# ab205921, RRID:AB_2687878 VEGF Abcam Cat# ab52917, RRID:AB_883427 Chemicals, peptides, and recombinant proteins Bafilomycin A1 MedChemExpress Cat#HY-100558 MG132 MedChemExpress Cat#HY-13259 ULK101 MedChemExpress Cat#HY-114490 Wortmannin MedChemExpress Cat#HY-10197 SAR405 MedChemExpress Cat#HY-12481 NSC185058 MedChemExpress Cat#HY-125169 NHS-biotin MedChemExpress Cat#HY-D0802 PKH26 Sigma-Aldrich Cat#MINI26 CFSE Selleck Cat#S8269 pHrodo deep red Thermofisher Cat#P35357 Critical commercial assays GST purification kit Beyotime Cat#P2262 NaveniFlex Cell Red PLA kit Naveni Cat#60025 Annexin V-FITC/PI apoptosis kit Elabscience Cat#E-CK-A211 Deposited data The mass spectrometry proteomics data This paper iProX: PXD072326 http://proteomecentral. proteomexchange.org/cgi/ GetDataset?ID=PXD072326 (Continued on next page) e1 Cell Chemical Biology 33, 1–15.e1–e7, April 16, 2026 .. HEK293T (female), HeLa (female), and A549 (male) cells were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (Gibco).

    Mass Spectrometry:

    Article Title: A nature-inspired nanoplatform for multi-protein targeted degradation via the autophagy-lysosome pathway.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Proteintech Cat# CL488-66002, RRID:AB_2919276 ATG7 Proteintech Cat# 10088-2-AP, RRID:AB_2062351 β-actin Proteintech Cat# 81115-1-RR, RRID:AB_2923704 LampI Abcam Cat# ab25630, RRID:AB_470708 LampII Proteintech Cat# 27823-1-AP, RRID:AB_2880983 TMEM201 Proteintech Cat# 24092-1-AP, RRID:AB_2879430 SFXN4 Affinity Cat# DF3325, RRID:AB_2835692 SEC11A Proteintech Cat# 14753-1-AP, RRID:AB_2186230 SNX18 Proteintech Cat# 21946-1-AP, RRID:AB_11182387 REEP4 Proteintech Cat# 26650-1-AP, RRID:AB_2880589 SUN2 Proteintech Cat# 27556-1-AP, RRID:AB_2880906 LC3B Proteintech Cat# CL594-18725, RRID:AB_2919848 CD63 Proteintech Cat# 25682-1-AP, RRID:AB_2783831 ALIX Proteintech Cat# 12422-1-AP, RRID:AB_2162467 CD9 Proteintech Cat# 60232-1-Ig, RRID:AB_11232215 TSG101 Proteintech Cat# 28283-1-AP, RRID:AB_2881104 HA Proteintech Cat# CL488-51064, RRID:AB_2935603 Flag Proteintech Cat# 66008-3-Ig, RRID:AB_2749837 GST Proteintech Cat# 66001-1-Ig, RRID:AB_10951482 EEA1 Proteintech Cat# 68065-1-Ig, RRID:AB_2918806 Rab7a Proteintech Cat# CL488-55469, RRID:AB_3084130 EGFR Abcam Cat# ab32198, RRID:AB_732100 PDL1 Abcam Cat# ab205921, RRID:AB_2687878 VEGF Abcam Cat# ab52917, RRID:AB_883427 Chemicals, peptides, and recombinant proteins Bafilomycin A1 MedChemExpress Cat#HY-100558 MG132 MedChemExpress Cat#HY-13259 ULK101 MedChemExpress Cat#HY-114490 Wortmannin MedChemExpress Cat#HY-10197 SAR405 MedChemExpress Cat#HY-12481 NSC185058 MedChemExpress Cat#HY-125169 NHS-biotin MedChemExpress Cat#HY-D0802 PKH26 Sigma-Aldrich Cat#MINI26 CFSE Selleck Cat#S8269 pHrodo deep red Thermofisher Cat#P35357 Critical commercial assays GST purification kit Beyotime Cat#P2262 NaveniFlex Cell Red PLA kit Naveni Cat#60025 Annexin V-FITC/PI apoptosis kit Elabscience Cat#E-CK-A211 Deposited data The mass spectrometry proteomics data This paper iProX: PXD072326 http://proteomecentral. proteomexchange.org/cgi/ GetDataset?ID=PXD072326 (Continued on next page) e1 Cell Chemical Biology 33, 1–15.e1–e7, April 16, 2026 .. HEK293T (female), HeLa (female), and A549 (male) cells were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (Gibco).



    Similar Products

    96
    Proteintech resource source identifier antibodies gfp proteintech
    Resource Source Identifier Antibodies Gfp Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/ATG7+Antibody/pm41932333-276-2-7
    Average 96 stars, based on 1 article reviews
    resource source identifier antibodies gfp proteintech - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Proteintech resource source identifier antibodies gfp tag proteintech
    Resource Source Identifier Antibodies Gfp Tag Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/GFP+tag+Antibody/pm41642709-275-2-8
    Average 96 stars, based on 1 article reviews
    resource source identifier antibodies gfp tag proteintech - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Proteintech resource source identifier anti-tom20-gfp proteintech cat
    Resource Source Identifier Anti Tom20 Gfp Proteintech Cat, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/TOM20+Antibody/pm41406946-292-2-8
    Average 96 stars, based on 1 article reviews
    resource source identifier anti-tom20-gfp proteintech cat - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Proteintech resource source identifier antibodies anti gfp proteintech
    Resource Source Identifier Antibodies Anti Gfp Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/GFP+tag+Antibody/pm41389201-228-2-7
    Average 96 stars, based on 1 article reviews
    resource source identifier antibodies anti gfp proteintech - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Proteintech anti resource source identifier chromotek gfp-booster alexafluor 488 proteintech gb2af488
    Anti Resource Source Identifier Chromotek Gfp Booster Alexafluor 488 Proteintech Gb2af488, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/CEL+Antibody/pm41205602-726-2-6
    Average 96 stars, based on 1 article reviews
    anti resource source identifier chromotek gfp-booster alexafluor 488 proteintech gb2af488 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Proteintech resource source identifier antibodies gfp tag polyclonal antibody proteintech
    Resource Source Identifier Antibodies Gfp Tag Polyclonal Antibody Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/GFP+tag+Antibody/pm40858110-279-2-10
    Average 96 stars, based on 1 article reviews
    resource source identifier antibodies gfp tag polyclonal antibody proteintech - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Proteintech resource source identifier antibodies rabbit polyclonal anti lc3 proteintech 14600 1 ap rabbit monoclonal anti gfp huabio t1607
    Resource Source Identifier Antibodies Rabbit Polyclonal Anti Lc3 Proteintech 14600 1 Ap Rabbit Monoclonal Anti Gfp Huabio T1607, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/LC3+Antibody/pm39952286-352-2-9
    Average 96 stars, based on 1 article reviews
    resource source identifier antibodies rabbit polyclonal anti lc3 proteintech 14600 1 ap rabbit monoclonal anti gfp huabio t1607 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Proteintech anti resource source identifier gfp proteintech 66002-1-ig α-tubulin proteintech 66031-1-ig
    Anti Resource Source Identifier Gfp Proteintech 66002 1 Ig α Tubulin Proteintech 66031 1 Ig, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+gfp+proteintech/GFP+tag+Antibody/10__1016_slash_j__isci__2025__112753-197-2-7
    Average 96 stars, based on 1 article reviews
    anti resource source identifier gfp proteintech 66002-1-ig α-tubulin proteintech 66031-1-ig - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results